Format for Individual Target pages (copy this list to new Target page and then fill in for your target):
*Target (protein/gene name): Dihydrodipicolinate Reductase DAPB (DHPR) *NCBI Gene # or RefSeq#:888443 *Protein ID (NP or XP #) or Wolbachia#: 217289.1 *Organism (including strain):Mycobacterium tuberculosis H37Rv Etiologic Risk Group (see link below): Appendix B-III-A. Risk Group 3 (RG3) - Bacterial Agents Including Rickettsia *Background/Disease Information (sort of like the Intro to your Mini Research Write up):
Mycobacterium tuberculosis originates from a pathogenic bacterial species from the family Mycobacteriaceae. This bacteria is a cause of the disease tuberculosis. Tuberculosis is a lethal, infectious disease that is quite common. Tuberculosis causes symptoms in the lungs and can also cause problems in other parts of the body too. Most symptoms of tuberculosis are asymptomatic, but these infections can eventually progress to an active disease which could kill if activated and untreated. Tuberculosis can infect any part of the body, but it usually infects the lungs (pulmonary tuberculosis) Tuberculosis is spread through the air when people with TB infection cough, sneeze and release pathogenic bacteria into the air.
Symptoms of tuberculosis include chronic fever, night sweats, coughing up blood, and weight loss. However, those are just the basic and most common symptoms of tuberculosis. The infection could spread to other parts of the body and thus cause a wide range of symptoms.
This disease is classified as a granulomatous inflammatory disease, where grauloma prevents dissemination of the mycobacteria and allows for a local environment for interaction of cells in the immune system.
There is a vaccine currently available for tuberculosis called bacillus Calmette-Guerin (BCG), but it is inconsistent in protecting against pulmonary TB. However, since it is effective against disseminated disease in childhood, it is widely used. One negative result of this vaccine is that it causes the tuberculin skin test to come out falsely positive.
Treatment for tuberculosis is difficult and long term. It requires adminitsration of multiple antibiotics continuously. A problem in recent years is the ongoing antibiotic resistance in multiple drug-resistant tuberculosis infections.
--Show screenshot of BRENDA enzyme mechanism schematic
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents):
Assayed through using the Yamakura te al. (1974) method. Assay mixture contains 200 mM Tris/HCL buffer pH 8, 4 mM of sodium pyruvate, 2 mM i-aspartate semialdehyde, and cell extract. This was then put into incubation at 37°C for 10 min. At the end of this time, the 1 ml assay mixture was mixed with 1 ml 1 M HCl and 1 ml o-aminobenzaldehyde (2 mg ml−1 in ethanol). For another 30 minutes this mixture was incubated in the dark and then finally centrifuged. The supernatant was then used to find absorbance at 540 nm.
Structure Available (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model: 1YL5
-- For Homology Model option: N/A
---- Show pairwise alignment of your BLASTP search in NCBI against the PDB: N/A
---- Query Coverage: N/A
---- Max % Identities: N/A
---- % Positives N/A
---- Chain used for homology: N/A Current Inhibitors: A number of sulfonamide compounds were found through FLOG-based molecular modeling search as potent inhibitors. Some specific compounds include L-346,291, L-584,024, and L-586,078. http://www.sciencedirect.com/science/article/pii/S0167483800002624 Expression Information (has it been expressed in bacterial cells): Yes, in Staphylococcus auerus http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2805538/ Purification Method: (standard chromatographic techniques)
In order to remove unbound proteins, the column was first washed with five column volumes of buffer A, then with five column volumes of buffer B [20 mM Tris pH 8.0, 1 M NaCl, 10 mM imidazole, 5%(v/v) glycerol, 2 mM β-ME] and finally with five column volumes of buffer C [20 mM Tris pH 8.0, 250 mM NaCl, 50 mM imidazole, 5%(v/v) glycerol]. The protein was eluted by running a linear gradient from 50 to 800 mM imidazole (in buffer C). The major peak fractions were pooled and dialyzed against buffer D [20 mM Tris pH 8.0, 250 mM NaCl, 5%(v/v) glycerol]. During overnight dialysis at 277 K, the His tag was cleaved off the protein produced from the pETM-11 construct by adding TEV protease. The cleaved and dialyzed protein solution was passed through a Hi-Trap Chelating HP column pre-equilibrated with buffer D and recovered in the flowthrough. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1952461/
Image of protein (PyMol with features delineated and shown separately):
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
*length of your protein in AminoAcids: 288 residues Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website"
66698.2 DA
Molar Extinction coefficient of your protein at 280 nm wavelength:
Ext. coefficient 11500 Abs 0.1% (=1 g/l) 0.172, assuming all pairs of Cys residues form cystines
Ext. coefficient 0 Abs 0.1% (=1 g/l) 0.000, assuming all Cys residues are reduced
*CDS Gene Sequence (paste as text only): ATGCATGATGCAAACATCCGCGTTGCCATCGCGGGAGCCGGGGGGCGTATGGGCCGCCAGTTGATTCAGG CGGCGCTGGCATTAGAGGGCGTGCAGTTGGGCGCTGCGCTGGAGCGTGAAGGATCTTCTTTACTGGGCAG CGACGCCGGTGAGCTGGCCGGAGCCGGGAAAACAGGCGTTACCGTGCAAAGCAGCCTCGATGCGGTAAAA GATGATTTTGATGTGTTTATCGATTTTACCCGTCCGGAAGGTACGCTGAACCATCTCGCTTTTTGTCGCC AGCATGGCAAAGGGATGGTGATCGGCACTACGGGGTTTGACGAAGCCGGTAAACAAGCAATTCGTGACGC CGCTGCCGATATTGCGATTGTCTTTGCTGCCAATTTTAGCGTTGGCGTTAACGTCATGCTTAAGCTGCTG GAGAAAGCAGCCAAAGTGATGGGTGACTACACCGATATCGAAATTATTGAAGCACATCATAGACATAAAG TTGATGCGCCGTCAGGCACCGCACTGGCAATGGGAGAGGCGATCGCCCACGCCCTTGATAAAGATCTGAA AGATTGCGCGGTCTACAGTCGTGAAGGCCACACCGGTGAACGTGTGCCTGGCACCATTGGTTTTGCCACC GTGCGTGCAGGTGACATCGTTGGTGAACATACCGCGATGTTTGCCGATATTGGCGAGCGTCTGGAGATCA CCCATAAGGCGTCCAGCCGTATGACATTTGCTAACGGCGCGGTAAGATCGGCTTTGTGGTTGAGTGGTAA GGAAAGCGGTCTTTTTGATATGCGAGATGTACTTGATCTCAATAATTTGTAA *GC% Content for gene:
53.406326034063
Do Not Need this info for Spring (but still copy these lines to your Target page for now) Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers): (link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
Primer design results for 'tail' primers (this is just 2 sequences):
Format for Individual Target pages (copy this list to new Target page and then fill in for your target):
*Target (protein/gene name): Dihydrodipicolinate Reductase DAPB (DHPR)*NCBI Gene # or RefSeq#: 888443
*Protein ID (NP or XP #) or Wolbachia#: 217289.1
*Organism (including strain): Mycobacterium tuberculosis H37Rv
Etiologic Risk Group (see link below): Appendix B-III-A. Risk Group 3 (RG3) - Bacterial Agents Including Rickettsia
*Background/Disease Information (sort of like the Intro to your Mini Research Write up):
Mycobacterium tuberculosis originates from a pathogenic bacterial species from the family Mycobacteriaceae. This bacteria is a cause of the disease tuberculosis. Tuberculosis is a lethal, infectious disease that is quite common. Tuberculosis causes symptoms in the lungs and can also cause problems in other parts of the body too. Most symptoms of tuberculosis are asymptomatic, but these infections can eventually progress to an active disease which could kill if activated and untreated. Tuberculosis can infect any part of the body, but it usually infects the lungs (pulmonary tuberculosis) Tuberculosis is spread through the air when people with TB infection cough, sneeze and release pathogenic bacteria into the air.
Symptoms of tuberculosis include chronic fever, night sweats, coughing up blood, and weight loss. However, those are just the basic and most common symptoms of tuberculosis. The infection could spread to other parts of the body and thus cause a wide range of symptoms.
This disease is classified as a granulomatous inflammatory disease, where grauloma prevents dissemination of the mycobacteria and allows for a local environment for interaction of cells in the immune system.
There is a vaccine currently available for tuberculosis called bacillus Calmette-Guerin (BCG), but it is inconsistent in protecting against pulmonary TB. However, since it is effective against disseminated disease in childhood, it is widely used. One negative result of this vaccine is that it causes the tuberculin skin test to come out falsely positive.
Treatment for tuberculosis is difficult and long term. It requires adminitsration of multiple antibiotics continuously. A problem in recent years is the ongoing antibiotic resistance in multiple drug-resistant tuberculosis infections.
Essentiality of this protein:
Gene/Ortholog: mtu2820 (OG4_14431); Phenotype: non-essential; Source study: nmpdr
Gene/Ortholog: eco32 (OG4_14431); Phenotype: undefined; Source study: blattner
Gene/Ortholog: eco32 (OG4_14431); Phenotype: essential; Source study: gerdes
Gene/Ortholog: eco32 (OG4_14431); Phenotype: essential; Source study: keio
Gene/Ortholog: eco32 (OG4_14431); Phenotype: non-essential; Source study: shigen
Complex of proteins?: No
Druggable Target: Yes, 0.2 druggability index
*EC#: 1.3.1.26
Link to BRENDA EC# page:
http://www.brenda-enzymes.org/php/result_flat.php4?ecno=1.3.1.26
-- Show screenshot of BRENDA enzyme mechanism schematic
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents):
Assayed through using the Yamakura te al. (1974) method. Assay mixture contains 200 mM Tris/HCL buffer pH 8, 4 mM of sodium pyruvate, 2 mM i-aspartate semialdehyde, and cell extract. This was then put into incubation at 37°C for 10 min. At the end of this time, the 1 ml assay mixture was mixed with 1 ml 1 M HCl and 1 ml o-aminobenzaldehyde (2 mg ml−1 in ethanol). For another 30 minutes this mixture was incubated in the dark and then finally centrifuged. The supernatant was then used to find absorbance at 540 nm.
-- link to Sigma (or other company) page for assay or assay reagents (substrates)
http://www.sigmaaldrich.com/catalog/search?interface=All&term=sodium+pyruvate&lang=en®ion=US&focus=product&N=0+220003048+219853269+219853286&mode=match%20partialmax
http://www.glycosyn.com/chemical-list/s-aspartate-semi-aldehyde
http://www.sigmaaldrich.com/catalog/search?interface=All&term=HCl&lang=en®ion=US&focus=product&N=0+220003048+219853269+219853286&mode=match%20partialmax
http://www.sigmaaldrich.com/catalog/search?interface=All&term=o-aminobenzaldehyde&lang=en®ion=US&focus=product&N=0+220003048+219853269+219853286&mode=match%20partialmax
-- link (or citation) to paper that contains assay information
http://mic.sgmjournals.org/content/152/1/105.full
-- List cost and quantity of substrate reagents and supplier
2-Aminobenzaldehyde: 100 MG, $58.50
Sodium pyruvate: 10 MG, $19.90
i-aspartate semialdehyde: 10 MG, $350.00
Hydrochloric acid: 100 ML, $48.50
Structure Available (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model: 1YL5
-- For Homology Model option: N/A
---- Show pairwise alignment of your BLASTP search in NCBI against the PDB: N/A
---- Query Coverage: N/A
---- Max % Identities: N/A
---- % Positives N/A
---- Chain used for homology: N/A
Current Inhibitors: A number of sulfonamide compounds were found through FLOG-based molecular modeling search as potent inhibitors. Some specific compounds include L-346,291, L-584,024, and L-586,078.
http://www.sciencedirect.com/science/article/pii/S0167483800002624
Expression Information (has it been expressed in bacterial cells): Yes, in Staphylococcus auerus
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2805538/
Purification Method: (standard chromatographic techniques)
In order to remove unbound proteins, the column was first washed with five column volumes of buffer A, then with five column volumes of buffer B [20 mM Tris pH 8.0, 1 M NaCl, 10 mM imidazole, 5%(v/v) glycerol, 2 mM β-ME] and finally with five column volumes of buffer C [20 mM Tris pH 8.0, 250 mM NaCl, 50 mM imidazole, 5%(v/v) glycerol]. The protein was eluted by running a linear gradient from 50 to 800 mM imidazole (in buffer C). The major peak fractions were pooled and dialyzed against buffer D [20 mM Tris pH 8.0, 250 mM NaCl, 5%(v/v) glycerol]. During overnight dialysis at 277 K, the His tag was cleaved off the protein produced from the pETM-11 construct by adding TEV protease. The cleaved and dialyzed protein solution was passed through a Hi-Trap Chelating HP column pre-equilibrated with buffer D and recovered in the flowthrough.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1952461/
Image of protein (PyMol with features delineated and shown separately):
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
1 <span class="ff_line">mtepqtttqa taprslrlgl vgygrmgrmv htvaqerghr vtavidphap gatapaltpe</span> 61 <span class="ff_line">lagqvdavid fsapatardn ilfygrsgip avvgttgwyd qlsaiqaela gqpaaivwsg</span> 121 <span class="ff_line">nfsigvrlft rlaaqaaalf apfadydall hefhhagkad spsgtalqla qavqsewprq</span> 181 <span class="ff_line">pqletgrldr qrrpqelhls strgghipgt htlifdspad tvelthrart regfaagavq</span> 241 <span class="ff_line">aaewlaggrr glftldelld dvfaaqmgtg aspqpkhkps pdtaark</span>*length of your protein in Amino Acids: 288 residues
Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website"
66698.2 DA
Molar Extinction coefficient of your protein at 280 nm wavelength:
Ext. coefficient 11500 Abs 0.1% (=1 g/l) 0.172, assuming all pairs of Cys residues form cystines
Ext. coefficient 0 Abs 0.1% (=1 g/l) 0.000, assuming all Cys residues are reduced
TMpred graph Image (http://www.ch.embnet.org/software/TMPRED_form.html). Input your amino acid sequence to it.
*CDS Gene Sequence (paste as text only):
ATGCATGATGCAAACATCCGCGTTGCCATCGCGGGAGCCGGGGGGCGTATGGGCCGCCAGTTGATTCAGG CGGCGCTGGCATTAGAGGGCGTGCAGTTGGGCGCTGCGCTGGAGCGTGAAGGATCTTCTTTACTGGGCAG CGACGCCGGTGAGCTGGCCGGAGCCGGGAAAACAGGCGTTACCGTGCAAAGCAGCCTCGATGCGGTAAAA GATGATTTTGATGTGTTTATCGATTTTACCCGTCCGGAAGGTACGCTGAACCATCTCGCTTTTTGTCGCC AGCATGGCAAAGGGATGGTGATCGGCACTACGGGGTTTGACGAAGCCGGTAAACAAGCAATTCGTGACGC CGCTGCCGATATTGCGATTGTCTTTGCTGCCAATTTTAGCGTTGGCGTTAACGTCATGCTTAAGCTGCTG GAGAAAGCAGCCAAAGTGATGGGTGACTACACCGATATCGAAATTATTGAAGCACATCATAGACATAAAG TTGATGCGCCGTCAGGCACCGCACTGGCAATGGGAGAGGCGATCGCCCACGCCCTTGATAAAGATCTGAA AGATTGCGCGGTCTACAGTCGTGAAGGCCACACCGGTGAACGTGTGCCTGGCACCATTGGTTTTGCCACC GTGCGTGCAGGTGACATCGTTGGTGAACATACCGCGATGTTTGCCGATATTGGCGAGCGTCTGGAGATCA CCCATAAGGCGTCCAGCCGTATGACATTTGCTAACGGCGCGGTAAGATCGGCTTTGTGGTTGAGTGGTAA GGAAAGCGGTCTTTTTGATATGCGAGATGTACTTGATCTCAATAATTTGTAA
*GC% Content for gene:
53.406326034063
Do Not Need this info for Spring (but still copy these lines to your Target page for now)
Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):
(link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
Primer design results for 'tail' primers (this is just 2 sequences):